T64 Primer Detail MGI Mouse MGI:736

T64 Primer Detail

Name

T64
Primer 1 Sequence

CATTTGAGGACAGTCAGGATC
Primer 2 Sequence

GGAACTTTCATGCAGTACTAG
ID

MGI:736

D12Nds11	DNA segment, Chr 12, Nuffield Department of Surgery 11
Odc1	ornithine decarboxylase, structural 1

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D12Nds11	d	175bp	DBA/2J
	e	170bp	B6.Cg-Lep^ob/+, C57BL/6J
	f	178bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, CAST/EiJ, NOD/MrkTac
	s	158bp	SPRET/EiJ

J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4

Endonuclease	Gene	Allele	Fragments	Strains
	D12Nds11	a	larger	AKR/J, LG/J, SM/J
	D12Nds11	b	smaller	C57BL/J

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23