About   Help   FAQ
T64 Primer Detail
Primers
  • Name
    T64
  • Primer 1 Sequence
    CATTTGAGGACAGTCAGGATC
  • Primer 2 Sequence
    GGAACTTTCATGCAGTACTAG
  • ID
    MGI:736
Genes
D12Nds11 DNA segment, Chr 12, Nuffield Department of Surgery 11
Odc1 ornithine decarboxylase, structural 1
Polymorphisms
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D12Nds11 d 175bp DBA/2J
e 170bp B6.Cg-Lepob/+, C57BL/6J
f 178bp A/J, AKR/J, BALB/cJ, C3H/HeJ, CAST/EiJ, NOD/MrkTac
s 158bp SPRET/EiJ
J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4
Endonuclease Gene Allele Fragments Strains
D12Nds11 a larger AKR/J, LG/J, SM/J
b smaller C57BL/J
References
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory