About   Help   FAQ
T14 Primer Detail
Primers
  • Name
    T14
  • Primer 1 Sequence
    CCTTTCTGAAAGTATTAAGAGT
  • Primer 2 Sequence
    ACAACCATCTGCATATCCAGC
  • ID
    MGI:733
Genes
D11Nds9 DNA segment, Chr 11, Nuffield Department of Surgery 9
Il5 interleukin 5
Polymorphisms
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D11Nds9 e 306bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J
f 309bp CAST/EiJ
i 302bp NOD/MrkTac, NON/ShiLt
J:19832 Kuramoto T, et al., Int Immunol. 1994 Jul;6(7):991-4
Notes: ALY is a partially inbred strain carrying the mutation aly/aly.
Endonuclease Gene Allele Fragments Strains
D11Nds9 a not given ALY
m not given MSM/Ms
J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4
Endonuclease Gene Allele Fragments Strains
D11Nds9 a larger AKR/J, C57BL/J, SM/J
l smaller LG/J
References
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:19832 Kuramoto T, et al., The alymphoplasia (aly) mutation co-segregates with the intercellular adhesion molecule-2 (lcam-2) on mouse chromosome 11. Int Immunol. 1994 Jul;6(7):991-4
J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory