About   Help   FAQ
T12 Primer Detail
Primers
  • Name
    T12
  • Primer 1 Sequence
    AACTGTTCAAAGCCATTTCG
  • Primer 2 Sequence
    CTATGGACTCACAGCCAGGCT
  • ID
    MGI:732
Genes
D11Nds7 DNA segment, Chr 11, Nuffield Department of Surgery 7
Gfap glial fibrillary acidic protein
Polymorphisms
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D11Nds7 d 153bp A/J, AKR/J, BALB/cJ, DBA/2J, NON/ShiLt
e 163bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, NOD/MrkTac, SPRET/EiJ
f 181bp CAST/EiJ
J:19832 Kuramoto T, et al., Int Immunol. 1994 Jul;6(7):991-4
Notes: ALY is a partially inbred strain carrying the mutation aly/aly.
Endonuclease Gene Allele Fragments Strains
D11Nds7 a not given ALY
m not given MSM/Ms
References
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:19832 Kuramoto T, et al., The alymphoplasia (aly) mutation co-segregates with the intercellular adhesion molecule-2 (lcam-2) on mouse chromosome 11. Int Immunol. 1994 Jul;6(7):991-4
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory