About   Help   FAQ
Pgk1-pA, Pgk1-pB Primer Detail
Primers
  • Name
    Pgk1-pA, Pgk1-pB
  • Primer 1 Sequence
    TTCTCCTCTTCCTCATCTCC
  • Primer 2 Sequence
    TAAAGGACACATTTGGTCGC
  • ID
    MGI:7247
Genes
Pgk1 phosphoglycerate kinase 1
Polymorphisms
J:32578 Shanmugam V, et al., Biochem Genet. 1996 Feb;34(1-2):17-29
Endonuclease Gene Allele Fragments Strains
HpaII/Tth111I Pgk1 a 345bp B6.Cg-Pgk1a/J, CAST/EiJ, MOLF/EiJ, MOLG/DnJ, PWK
b 272,73bp A.SW-H2s/Sn, BALB/cByJ, C3H, C57BL/6J-Hprt1a, C57BL/10, CBA/CaHN-Btkxid/J, FAIYUM-3, M. m. macedonicus, NZB/BlNJ, NZW/LacJ, PL/J, SF/CamEiJ, SK/CamEi, SPRET/EiJ, STU
J:74919 Grzmil P, Personal Communication. 2002;
Endonuclease Gene Allele Fragments Strains
Tth111l Pgk1 b 272bp, 73bp AKR/J, B10.BR-H2k, DBA/2, KE, KP
References
J:32578 Shanmugam V, et al., A novel Tth111I restriction fragment length polymorphism (RFLP) allows tracing of X-chromosome inactivation in the (Xid) heterozygote. Biochem Genet. 1996 Feb;34(1-2):17-29
J:74919 Grzmil P, Polymorphism of the Pgk1 gene in mouse. Personal Communication. 2002;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory