About   Help   FAQ
Tcp10msF, Tcp10msR Primer Detail
Primers
  • Name
    Tcp10msF, Tcp10msR
  • Primer 1 Sequence
    GCGTGCCCCTTGGACAGGG
  • Primer 2 Sequence
    GCTGTACTGTAACCTTGCTTAG
  • ID
    MGI:7243
  • Region Covered
    intron 1 of the Tcp10b gene
  • Product Size
    250-300bp
  • Note
    This primer pair amplifies microsatellite alleles from the various members of the Tcp10 family.
Genes
Tcp10 t-complex protein 10
Tcp10a t-complex protein 10a
Tcp10b t-complex protein 10b
Polymorphisms
J:33200 Ardlie KG, et al., Genet Res. 1996 Feb;67(1):1-10
Endonuclease Gene Allele Fragments Strains
Tcp10 a 293,292bp 129X1/SvJ
b 298,278bp C57BL/6
c 288bp C3H/He
d 286,278,276bp C3.t0
e 286,274,270bp C3H-tw2
f 280,268bp C3.t12, STOCK tw32
g 294,274,273bp C3.tw12
h 290,278bp C3.tw73
i 294,274,272bp C3.tw18
j 286,276,270bp STOCK tLub3
k 284,278,270bp STOCK tLub1
l 288,278,270bp STOCK tLub4, STOCK tLub6
m 286,278bp STOCK tLub8, STOCK tTuw24
n 274,270,258bp STOCK tTuw11
o 280bp STOCK tTuw32
p 294,278,272bp (STOCK T(3;12)58H x 129X1/SvJ)F1, (STOCK T(7;16)67H x 129X1/SvJ)F1, (T(1;2)5Ca x 129X1/SvJ)F1
q 294,274,272bp (CF109 x 129X1/SvJ)F1, (STOCK T(2;19)68H x 129X1/SvJ)F1
r 280,276bp (BM1 x 129X1/SvJ)F1
s 280,274,264bp (PV1 x 129X1/SvJ)F1
t 286,274bp (MV1 x 129X1/SvJ)F1
u 294,274,266bp C3.tw5
References
J:33200 Ardlie KG, et al., Recent evolution of mouse t haplotypes at polymorphic microsatellites associated with the t complex responder (Tcr) locus. Genet Res. 1996 Feb;67(1):1-10

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory