About   Help   FAQ
Cf2r-pA, Cf2r-pB Primer Detail
Primers
  • Name
    Cf2r-pA, Cf2r-pB
  • Primer 1 Sequence
    GTACGCAAGGTTTAACTCCAGCAGC
  • Primer 2 Sequence
    CAAGTCGGGCTCAGTTACCCTACACC
  • ID
    MGI:7219
  • Region Covered
    exon 2
Genes
F2r coagulation factor II thrombin receptor
Polymorphisms
J:32825 Poirier C, et al., Mamm Genome. 1996 Apr;7(4):322
Endonuclease Gene Allele Fragments Strains
F2r a 0.31kb AKR/J, SEG
b 0.32kb C57BL/6J, C57L/J
J:33579 Seymour AB, et al., Genome Res. 1996 Jun;6(6):538-44
Endonuclease Gene Allele Fragments Strains
F2r m 320bp STOCK Foxq1sa Bloc1s5mu Ap3b1pe
p 340bp PWK
References
J:32825 Poirier C, et al., The gene encoding the thrombin receptor (Cf2r) maps to mouse Chromosome 13. Mamm Genome. 1996 Apr;7(4):322
J:33579 Seymour AB, et al., An integrated genetic map of the pearl locus of mouse chromosome 13. Genome Res. 1996 Jun;6(6):538-44

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory