About   Help   FAQ
D2Mit6 Primer Detail
Primers
  • Name
    D2Mit6
  • Primer 1 Sequence
    AACAAACAAACCCCTTGCCC
  • Primer 2 Sequence
    CTCTAACACAGCCCCAGGTG
  • ID
    MGI:707815
  • Product Size
    135
  • Other IDs
    D2Mit6 (BROAD)
  • Note
    MIT assay: L18
    Additional information: MIT STS Marker Data Files
Genes
D2Mit6 DNA segment, Chr 2, Massachusetts Institute of Technology 6
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D2Mit6 a 124bp 129X1/Sv
f 105bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit6 a 105bp SPRET/EiJ
b 124bp A/J, AKR/J, DBA/2J
c 132bp B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
d 143bp CAST/EiJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory