About   Help   FAQ
D10Mit106 Primer Detail
Primers
  • Name
    D10Mit106
  • Primer 1 Sequence
    TGTGCTGGCATTCACTCTTC
  • Primer 2 Sequence
    ACAGTGACCTTCTGTGTAAAATGC
  • ID
    MGI:707812
  • Product Size
    125
  • Other IDs
    D10Mit106 (BROAD)
  • Note
    MIT assay: MT509
    Additional information: MIT STS Marker Data Files
Genes
D10Mit106 DNA segment, Chr 10, Massachusetts Institute of Technology 106
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit106 b 0.123kb B10.BR-H2k, BALB/cByJ, C57BL/6
c 0.135kb BALB.K-H2k, BALB/cAnNCr, BALB/cJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit106 a 123bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J
b 127bp SPRET/EiJ
c 135bp A/J, AKR/J, BALB/cJ, C3H/HeJ, LP/J, NON/ShiLt
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory