About   Help   FAQ
D2Mit355 Primer Detail
Primers
  • Name
    D2Mit355
  • Primer 1 Sequence
    GTCTTCCTTTGGGTAGTTCTCG
  • Primer 2 Sequence
    AAATAAATGTCTGCCTCTTTCCC
  • ID
    MGI:707799
  • Product Size
    147
  • Other IDs
    D2Mit355 (BROAD)
  • Note
    MIT assay: MJ4770
    Additional information: MIT STS Marker Data Files
Genes
D2Mit355 DNA segment, Chr 2, Massachusetts Institute of Technology 355
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit355 a 130bp SPRET/EiJ
b 142bp A/J, AKR/J, NOD/MrkTac, NON/ShiLt
c 147bp B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D2Mit355 a 147bp BALB/cW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
b 142bp A.CA/W, AKR/W
c 138bp BN/aW
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory