About   Help   FAQ
D3Mit60 Primer Detail
Primers
  • Name
    D3Mit60
  • Primer 1 Sequence
    GACATCCTGGGCAACATTG
  • Primer 2 Sequence
    GGTGTTGTTTGCTGTTGCTG
  • ID
    MGI:707795
  • Product Size
    170
  • Other IDs
    D3Mit60 (BROAD)
  • Note
    MIT assay: MPC428
    Additional information: MIT STS Marker Data Files
Genes
D3Mit60 DNA segment, Chr 3, Massachusetts Institute of Technology 60
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit60 a 160bp A/J, BALB/cJ, NOD/MrkTac
b 162bp C57BL/6J
c 168bp SPRET/EiJ
d 170bp LP/J
e 172bp B6.Cg-Lepob/+
f 180bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D3Mit60 c 129bp CBA/CaOlaHsd
s 127bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory