D3Mit63 Primer Detail MGI Mouse MGI:707794

D3Mit63 Primer Detail

Name

D3Mit63
Primer 1 Sequence

CTATGGACTTGTGACATAGGAGTG
Primer 2 Sequence

ACCACAAGATGGAGTAAGAGTTCA
ID

MGI:707794
Product Size

112
Other IDs

D3Mit63 (BROAD)
Note

MIT assay: MPC1714
Additional information: MIT STS Marker Data Files

D3Mit63

DNA segment, Chr 3, Massachusetts Institute of Technology 63

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit63	b	smaller	C57BL/6J
	D3Mit63	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit63	a	116bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	b	120bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J
	c	122bp	CAST/EiJ, NON/ShiLt
	d	132bp	SPRET/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23