About   Help   FAQ
DXMit119 Primer Detail
Primers
  • Name
    DXMit119
  • Primer 1 Sequence
    CTTTAACCATAATAATGGCCTTGC
  • Primer 2 Sequence
    GGGTTCTGTGATCGCAAGTT
  • ID
    MGI:707782
  • Product Size
    145
  • Other IDs
    DXMit119 (BROAD)
  • Note
    MIT assay: MT2948
    Additional information: MIT STS Marker Data Files
Genes
DXMit119 DNA segment, Chr X, Massachusetts Institute of Technology 119
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit119 a 134bp CAST/EiJ
b 144bp NOD/MrkTac
c 154bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J
d 160bp SPRET/EiJ
e 168bp A/J, AKR/J, C3H/HeJ, NON/ShiLt
f 170bp BALB/cJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
DXMit119 c 153bp CBA/CaOlaHsd
s 145bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory