About   Help   FAQ
DXMit118 Primer Detail
Primers
  • Name
    DXMit118
  • Primer 1 Sequence
    AGACTGTCTTTCTTCATAATGTCTGTG
  • Primer 2 Sequence
    TGCTATATTCATAGACTGGTACTGTGC
  • ID
    MGI:707781
  • Product Size
    134
  • Other IDs
    DXMit118 (BROAD)
  • Note
    MIT assay: MT2581
    Additional information: MIT STS Marker Data Files
Genes
DXMit118 DNA segment, Chr X, Massachusetts Institute of Technology 118
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified DXMit118 a 130bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 136bp 129X1/SvJ
c 124 CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit118 a 122bp CAST/EiJ
b 134bp B6.Cg-Lepob/+
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory