About   Help   FAQ
D14Mit193 Primer Detail
Primers
  • Name
    D14Mit193
  • Primer 1 Sequence
    CTCTGGCTTCTAAACAAAACACTG
  • Primer 2 Sequence
    CATGTGGACGTGTGTATACATCC
  • ID
    MGI:707777
  • Product Size
    118
  • Other IDs
    D14Mit193 (BROAD)
  • Note
    MIT assay: MT4024
    Additional information: MIT STS Marker Data Files
Genes
D14Mit193 DNA segment, Chr 14, Massachusetts Institute of Technology 193
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit193 a 122bp B6.Cg-Lepob/+, C57BL/6J
b 126bp NON/ShiLt
c 132bp AKR/J, BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J, NOD/MrkTac
d 134bp A/J, LP/J
e 158bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D14Mit193 c 127bp CBA/CaOlaHsd
s 126bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory