About   Help   FAQ
D9Mit22 Primer Detail
Primers
  • Name
    D9Mit22
  • Primer 1 Sequence
    ATTGCATAACACCCCCACAT
  • Primer 2 Sequence
    CAGTGCTTAACTGCTCAAATGC
  • ID
    MGI:707772
  • Product Size
    224
  • Other IDs
    D9Mit22 (BROAD)
  • Note
    MIT assay: d134
    Additional information: MIT STS Marker Data Files
Genes
D9Mit22 DNA segment, Chr 9, Massachusetts Institute of Technology 22
Polymorphisms
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D9Mit22 a largest DBA/2
b smaller C57BL/6, JF1, MSM/Ms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit22 a 212bp SPRET/EiJ
b 218bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
c 226bp BALB/cJ
d 228bp CAST/EiJ
e 230bp A/J, C3H/HeJ, DBA/2J
References
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory