About   Help   FAQ
D9Mit26 Primer Detail
Primers
  • Name
    D9Mit26
  • Primer 1 Sequence
    ATTGCATAACACCCCCACAT
  • Primer 2 Sequence
    CAGTGCTTAACTGCTCAAATGC
  • ID
    MGI:707768
  • Product Size
    224
  • Note
    MIT assay: D628
Genes
D9Mit26 DNA segment, Chr 9, Massachusetts Institute of Technology 26
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit26 a 210bp NOD/MrkTac, SPRET/EiJ
b 218bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, LP/J, NON/ShiLt
c 224bp BALB/cJ, CAST/EiJ
d 230bp A/J, C3H/HeJ, DBA/2J
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D9Mit26 c upper CBA/Kw
e lower KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory