D3Mit258 Primer Detail MGI Mouse MGI:707752

D3Mit258 Primer Detail

Name

D3Mit258
Primer 1 Sequence

ACACAGGAATATGGTGTGAGTCC
Primer 2 Sequence

AACAGTAGTAGAGGCAAGTAGTGTTTG
ID

MGI:707752
Product Size

218
Other IDs

D3Mit258 (BROAD)
Note

MIT assay: MT4372
Additional information: MIT STS Marker Data Files

D3Mit258

DNA segment, Chr 3, Massachusetts Institute of Technology 258

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit258	a	192bp	A/J, BALB/cJ, C3H/HeJ, LP/J
	b	217bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NON/ShiLt
	c	221bp	SPRET/EiJ
	d	223bp	CAST/EiJ
	e	225bp	NOD/MrkTac

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit258	c	192bp	129P3/J, AKR/OlaHsd, BALB/cJ, JF1, PWB, SJL/J
	D3Mit258	d	220bp	A/JOlaHsd, C3H/HeJ, C57BL/6JOlaHsd, C57BL/10, DBA/2J

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23