About   Help   FAQ
D11Mit104 Primer Detail
Primers
  • Name
    D11Mit104
  • Primer 1 Sequence
    CACATGATCATACACTGTTTCTCC
  • Primer 2 Sequence
    GCCACGTGTTCTAACCTTCC
  • ID
    MGI:707741
  • Product Size
    159
  • Other IDs
    D11Mit104 (BROAD)
  • Note
    MIT assay: MPC506
    Additional information: MIT STS Marker Data Files
Genes
D11Mit104 DNA segment, Chr 11, Massachusetts Institute of Technology 104
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D11Mit104 m 189bp MOLF/EiJ
s 172bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit104 a 156bp A/J, B6.Cg-Lepob/+, C57BL/6J
b 158bp AKR/J, NOD/MrkTac, NON/ShiLt
c 162bp BALB/cJ, C3H/HeJ, DBA/2J, LP/J
d 166bp SPRET/EiJ
e 178bp CAST/EiJ
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D11Mit104 a smaller 129P3/J
s larger SJL/J
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory