D15Mit8 Primer Detail MGI Mouse MGI:707740

D15Mit8 Primer Detail

Name

D15Mit8
Primer 1 Sequence

GGAAAAGGGAAAAAGATGTGC
Primer 2 Sequence

TATATTACACTTTCCTTTGCTGCA
ID

MGI:707740
Product Size

111
Note

MIT assay: A79

D15Mit8

DNA segment, Chr 15, Massachusetts Institute of Technology 8

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit8	c	123bp	C3HeB/FeJLe
	D15Mit8	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit8	a	115bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
	b	118bp	SPRET/EiJ
	c	119bp	LP/J
	d	121bp	CAST/EiJ
	e	123bp	C3H/HeJ, DBA/2J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24