D17Mit34 Primer Detail MGI Mouse MGI:707736

D17Mit34 Primer Detail

Name

D17Mit34
Primer 1 Sequence

TGTTGGAGCTGAATACACGC
Primer 2 Sequence

GGTCCTTGTTTATTCCCAGTACC
ID

MGI:707736
Product Size

127
Other IDs

D17Mit34 (BROAD)
Note

MIT assay: D521
Additional information: MIT STS Marker Data Files

D17Mit34

DNA segment, Chr 17, Massachusetts Institute of Technology 34

J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit34	a	smallest	CBA/J, P/J
		b	larger	A.CA-H2^f/Sn
		c	larger than above	SJL/J
		d	larger than above	C57BL/6J, M. spretus, SWR/J
		e	larger than above	SM/J
		f	larger than above	CAST/EiJ
		g	larger than above	DBA/2J
		h	larger than above	RIIIS/J

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit34	a	126bp	AKR/J, C3H/HeJ, NOD/MrkTac, NON/ShiLt
	b	148bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J, SPRET/EiJ
	c	154bp	CAST/EiJ
	d	156bp	A/J, BALB/cJ, DBA/2J

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit34	l	larger	LG/J
	D17Mit34	s	smaller	SM/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit34	c	124bp	CBA/CaOlaHsd
	D17Mit34	s	144bp	SWR/OlaHsd

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D17Mit34	a	156bp	BALB/cW, BN/aW, DBA/2W
	b	148bp	129/SvW, C57BL/6W, C57BL/10W
	c	126bp	A.CA/W, AKR/W, C3H/W, CBA/W

J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24