About   Help   FAQ
D17Mit34 Primer Detail
Primers
  • Name
    D17Mit34
  • Primer 1 Sequence
    TGTTGGAGCTGAATACACGC
  • Primer 2 Sequence
    GGTCCTTGTTTATTCCCAGTACC
  • ID
    MGI:707736
  • Product Size
    127
  • Other IDs
    D17Mit34 (BROAD)
  • Note
    MIT assay: D521
    Additional information: MIT STS Marker Data Files
Genes
D17Mit34 DNA segment, Chr 17, Massachusetts Institute of Technology 34
Polymorphisms
J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit34 a smallest CBA/J, P/J
b larger A.CA-H2f/Sn
c larger than above SJL/J
d larger than above C57BL/6J, M. spretus, SWR/J
e larger than above SM/J
f larger than above CAST/EiJ
g larger than above DBA/2J
h larger than above RIIIS/J
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit34 a 126bp AKR/J, C3H/HeJ, NOD/MrkTac, NON/ShiLt
b 148bp B6.Cg-Lepob/+, C57BL/6J, LP/J, SPRET/EiJ
c 154bp CAST/EiJ
d 156bp A/J, BALB/cJ, DBA/2J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D17Mit34 l larger LG/J
s smaller SM/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit34 c 124bp CBA/CaOlaHsd
s 144bp SWR/OlaHsd
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D17Mit34 a 156bp BALB/cW, BN/aW, DBA/2W
b 148bp 129/SvW, C57BL/6W, C57BL/10W
c 126bp A.CA/W, AKR/W, C3H/W, CBA/W
References
J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory