About   Help   FAQ
D16Mit178 Primer Detail
Primers
  • Name
    D16Mit178
  • Primer 1 Sequence
    TCTCTCTCTCCCCTCCCTTC
  • Primer 2 Sequence
    TCATTTTTGTTGTCTGCCTCC
  • ID
    MGI:707724
  • Product Size
    123
  • Other IDs
    D16Mit178 (BROAD)
  • Note
    MIT assay: MT5305
    Additional information: MIT STS Marker Data Files
Genes
D16Mit178 DNA segment, Chr 16, Massachusetts Institute of Technology 178
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D16Mit178 a 137bp 129X1/Sv
f 133, 137bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit178 a 127bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J
b 129bp SPRET/EiJ
c 133bp NON/ShiLt
d 135bp CAST/EiJ
e 137bp A/J, DBA/2J, LP/J, NOD/MrkTac
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory