D5Mit320 Primer Detail MGI Mouse MGI:707723

D5Mit320 Primer Detail

Name

D5Mit320
Primer 1 Sequence

CTGAGGTGTATGTATGTTGCATATATG
Primer 2 Sequence

TCCGGTCTCAGTACATGTACAA
ID

MGI:707723
Product Size

124
Other IDs

D5Mit320 (BROAD)
Note

MIT assay: MT4648
Additional information: MIT STS Marker Data Files

D5Mit320

DNA segment, Chr 5, Massachusetts Institute of Technology 320

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit320	a	101bp	A/J, BALB/cJ, DBA/2J, LP/J, NON/ShiLt
	b	111bp	NOD/MrkTac
	c	119bp	AKR/J, C3H/HeJ
	d	125bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	131bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D5Mit320	a	125bp	C57BL/6W, C57BL/10W
	b	119bp	AKR/W, BN/aW, C3H/W
	c	101bp	129/SvW, A.CA/W, BALB/cW, CBA/W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24