About   Help   FAQ
D5Mit320 Primer Detail
Primers
  • Name
    D5Mit320
  • Primer 1 Sequence
    CTGAGGTGTATGTATGTTGCATATATG
  • Primer 2 Sequence
    TCCGGTCTCAGTACATGTACAA
  • ID
    MGI:707723
  • Product Size
    124
  • Other IDs
    D5Mit320 (BROAD)
  • Note
    MIT assay: MT4648
    Additional information: MIT STS Marker Data Files
Genes
D5Mit320 DNA segment, Chr 5, Massachusetts Institute of Technology 320
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit320 a 101bp A/J, BALB/cJ, DBA/2J, LP/J, NON/ShiLt
b 111bp NOD/MrkTac
c 119bp AKR/J, C3H/HeJ
d 125bp B6.Cg-Lepob/+, C57BL/6J
e 131bp CAST/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D5Mit320 a 125bp C57BL/6W, C57BL/10W
b 119bp AKR/W, BN/aW, C3H/W
c 101bp 129/SvW, A.CA/W, BALB/cW, CBA/W, DBA/2W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory