About   Help   FAQ
D15Mit3 Primer Detail
Primers
  • Name
    D15Mit3
  • Primer 1 Sequence
    TTTCCATTTTGGAGCCAGAG
  • Primer 2 Sequence
    TATCCTTGTCCTGCCATCGT
  • ID
    MGI:707722
  • Product Size
    137
  • Other IDs
    D15Mit3 (BROAD)
  • Note
    MIT assay: L78
    Additional information: MIT STS Marker Data Files
Genes
D15Mit3 DNA segment, Chr 15, Massachusetts Institute of Technology 3
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D15Mit3 b larger C57BL/6J
f smaller FVB/N
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D15Mit3 m 140bp MOLF/EiJ
s 120bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit3 a 133bp C3H/HeJ, NOD/MrkTac
b 135bp BALB/cJ
c 137bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, LP/J, NON/ShiLt
d 139bp A/J, DBA/2J
e 148bp CAST/EiJ
f 150bp SPRET/EiJ
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory