About   Help   FAQ
D16Mit174 Primer Detail
Primers
  • Name
    D16Mit174
  • Primer 1 Sequence
    TTCTTGAGAATTTCCATAGTTCTCC
  • Primer 2 Sequence
    GCCCCCTCTCTCTGTATATGT
  • ID
    MGI:707695
  • Product Size
    200
  • Other IDs
    D16Mit174 (BROAD)
  • Note
    MIT assay: MT5262
    Additional information: MIT STS Marker Data Files
Genes
D16Mit174 DNA segment, Chr 16, Massachusetts Institute of Technology 174
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit174 a 200bp B6.Cg-Lepob/+, C57BL/6J
b 216bp AKR/J
c 224bp NOD/MrkTac, NON/ShiLt
d 228bp A/J, BALB/cJ, CAST/EiJ, DBA/2J, LP/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D16Mit174 a 228bp A.CA/W, BALB/cW, BN/aW, C3H/W, CBA/W, DBA/2W
b 216bp AKR/W
c 200bp 129/SvW, C57BL/6W, C57BL/10W
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D16Mit174 c larger CBA/Kw
e smaller KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory