D16Mit174 Primer Detail MGI Mouse MGI:707695

D16Mit174 Primer Detail

Name

D16Mit174
Primer 1 Sequence

TTCTTGAGAATTTCCATAGTTCTCC
Primer 2 Sequence

GCCCCCTCTCTCTGTATATGT
ID

MGI:707695
Product Size

200
Other IDs

D16Mit174 (BROAD)
Note

MIT assay: MT5262
Additional information: MIT STS Marker Data Files

DNA segment, Chr 16, Massachusetts Institute of Technology 174

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit174	a	200bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	216bp	AKR/J
	c	224bp	NOD/MrkTac, NON/ShiLt
	d	228bp	A/J, BALB/cJ, CAST/EiJ, DBA/2J, LP/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D16Mit174	a	228bp	A.CA/W, BALB/cW, BN/aW, C3H/W, CBA/W, DBA/2W
	b	216bp	AKR/W
	c	200bp	129/SvW, C57BL/6W, C57BL/10W

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit174	c	larger	CBA/Kw
	D16Mit174	e	smaller	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/09/2025 MGI 6.24