D1Mit306 Primer Detail MGI Mouse MGI:707662

D1Mit306 Primer Detail

Name

D1Mit306
Primer 1 Sequence

CACTGTGTAAGTCTTTTCTCCTGTG
Primer 2 Sequence

TGTAATCCCAGTATGGGGGA
ID

MGI:707662
Product Size

108
Other IDs

D1Mit306 (BROAD)
Note

MIT assay: MT2024
Additional information: MIT STS Marker Data Files

D1Mit306

DNA segment, Chr 1, Massachusetts Institute of Technology 306

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit306	a	91bp	SPRET/EiJ
	b	95bp	DBA/2J, LP/J, NOD/MrkTac
	c	112bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J
	d	146bp	AKR/J
	e	148bp	NON/ShiLt
	f	186bp	CAST/EiJ

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit306	c	upper	CBA/Kw
	D1Mit306	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23