About   Help   FAQ
D18Mit58 Primer Detail
Primers
  • Name
    D18Mit58
  • Primer 1 Sequence
    GAAGGAACTTGATTATTGTTCACA
  • Primer 2 Sequence
    GATCATCCACAGATAGTCCAAGC
  • ID
    MGI:707660
  • Product Size
    184
  • Other IDs
    D18Mit58 (BROAD)
  • Note
    MIT assay: MPC1517
    Additional information: MIT STS Marker Data Files
Genes
D18Mit58 DNA segment, Chr 18, Massachusetts Institute of Technology 58
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D18Mit58 m 202bp MOLF/EiJ
s 176bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit58 a 140bp SPRET/EiJ
b 176bp CAST/EiJ
c 186bp B6.Cg-Lepob/+, C57BL/6J
d 198bp AKR/J, LP/J, NOD/MrkTac, NON/ShiLt
e 200bp A/J
f 202bp BALB/cJ, C3H/HeJ, DBA/2J
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory