D18Mit57 Primer Detail MGI Mouse MGI:707659

D18Mit57 Primer Detail

Name

D18Mit57
Primer 1 Sequence

GTTGATTTGGCAGAATTGAGG
Primer 2 Sequence

TTCCCTTTGGTGAAAAGGAG
ID

MGI:707659
Product Size

150
Other IDs

D18Mit57 (BROAD)
Note

MIT assay: MPC1015
Additional information: MIT STS Marker Data Files

D18Mit57

DNA segment, Chr 18, Massachusetts Institute of Technology 57

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D18Mit57	m	160bp	MOLF/EiJ
Not Specified	D18Mit57	s	195bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D18Mit57	a	144bp	BALB/cJ, C3H/HeJ, DBA/2J
	b	150bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
	c	170bp	SPRET/EiJ
	d	174bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D18Mit57	a	160bp	A.CA/W
	b	150bp	129/SvW, AKR/W, BN/aW, C57BL/6W, C57BL/10W
	c	142bp	BALB/cW, C3H/W, CBA/W, DBA/2W

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24