About   Help   FAQ
D18Mit57 Primer Detail
Primers
  • Name
    D18Mit57
  • Primer 1 Sequence
    GTTGATTTGGCAGAATTGAGG
  • Primer 2 Sequence
    TTCCCTTTGGTGAAAAGGAG
  • ID
    MGI:707659
  • Product Size
    150
  • Other IDs
    D18Mit57 (BROAD)
  • Note
    MIT assay: MPC1015
    Additional information: MIT STS Marker Data Files
Genes
D18Mit57 DNA segment, Chr 18, Massachusetts Institute of Technology 57
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D18Mit57 m 160bp MOLF/EiJ
s 195bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit57 a 144bp BALB/cJ, C3H/HeJ, DBA/2J
b 150bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac, NON/ShiLt
c 170bp SPRET/EiJ
d 174bp CAST/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D18Mit57 a 160bp A.CA/W
b 150bp 129/SvW, AKR/W, BN/aW, C57BL/6W, C57BL/10W
c 142bp BALB/cW, C3H/W, CBA/W, DBA/2W
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory