About   Help   FAQ
D18Mit55 Primer Detail
Primers
  • Name
    D18Mit55
  • Primer 1 Sequence
    ACAGATGTTCCCCAGCATTC
  • Primer 2 Sequence
    TGAGTGTGAGATCAGCCTGTG
  • ID
    MGI:707657
  • Product Size
    159
  • Other IDs
    D18Mit55 (BROAD)
  • Note
    MIT assay: MPC1430
    Additional information: MIT STS Marker Data Files
Genes
D18Mit55 DNA segment, Chr 18, Massachusetts Institute of Technology 55
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit55 a 124bp SPRET/EiJ
b 152bp A/J, DBA/2J
c 158bp CAST/EiJ
d 160bp B6.Cg-Lepob/+, C57BL/6J
e 166bp AKR/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D18Mit55 a 167bp AKR/OlaHsd
b 157bp C57BL/6JOlaHsd, C57BL/10
c 163bp 129P3/J, BALB/cJ, C3H/HeJ
d 149bp A/JOlaHsd, DBA/2J, SJL/J
j 159bp JF1
p 153bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory