About   Help   FAQ
D18Mit51 Primer Detail
Primers
  • Name
    D18Mit51
  • Primer 1 Sequence
    AACATGGTGGAAACCAACTACC
  • Primer 2 Sequence
    AAGGGAAAGTCACCACATGC
  • ID
    MGI:707653
  • Product Size
    196
  • Other IDs
    D18Mit51 (BROAD)
  • Note
    MIT assay: MPC1533
    Additional information: MIT STS Marker Data Files
Genes
D18Mit51 DNA segment, Chr 18, Massachusetts Institute of Technology 51
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D18Mit51 a 196bp 129X1/Sv
f 150, 196bp CD-1
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D18Mit51 m 198bp MOLF/EiJ
s 86bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit51 a 86bp CAST/EiJ, SPRET/EiJ
b 150bp AKR/J, NOD/MrkTac, NON/ShiLt
c 154bp A/J, BALB/cJ
d 194bp DBA/2J
e 196bp LP/J
f 198bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D18Mit51 l larger LG/J
s smaller SM/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory