About   Help   FAQ
D13Mit78 Primer Detail
Primers
  • Name
    D13Mit78
  • Primer 1 Sequence
    ACAGCACGGGTTTATCATCC
  • Primer 2 Sequence
    TATGCCTGCCAGGCTTCTAT
  • ID
    MGI:707630
  • Product Size
    229
  • Other IDs
    D13Mit78 (BROAD)
  • Note
    MIT assay: MPC1134
    Additional information: MIT STS Marker Data Files
Genes
D13Mit78 DNA segment, Chr 13, Massachusetts Institute of Technology 78
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D13Mit78 a 226bp 129X1/Sv
f 210bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit78 a 206bp NOD/MrkTac
b 210bp A/J, AKR/J, BALB/cJ, NON/ShiLt
c 222bp CAST/EiJ, SPRET/EiJ
d 226bp B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D13Mit78 c larger C58/J
f not given FVB/NJ
I not given I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D13Mit78 c 226bp CBA/CaOlaHsd
s 227bp SWR/OlaHsd
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D13Mit78 a larger 129P3/J
s smaller SJL/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory