D13Mit78 Primer Detail MGI Mouse MGI:707630

D13Mit78 Primer Detail

Name

D13Mit78
Primer 1 Sequence

ACAGCACGGGTTTATCATCC
Primer 2 Sequence

TATGCCTGCCAGGCTTCTAT
ID

MGI:707630
Product Size

229
Other IDs

D13Mit78 (BROAD)
Note

MIT assay: MPC1134
Additional information: MIT STS Marker Data Files

D13Mit78

DNA segment, Chr 13, Massachusetts Institute of Technology 78

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit78	a	226bp	129X1/Sv
Not Specified	D13Mit78	f	210bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit78	a	206bp	NOD/MrkTac
	b	210bp	A/J, AKR/J, BALB/cJ, NON/ShiLt
	c	222bp	CAST/EiJ, SPRET/EiJ
	d	226bp	B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D13Mit78	c	larger	C58/J
	f	not given	FVB/NJ
	I	not given	I/LnJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit78	c	226bp	CBA/CaOlaHsd
	D13Mit78	s	227bp	SWR/OlaHsd

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit78	a	larger	129P3/J
	D13Mit78	s	smaller	SJL/J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24