D3Mit147 Primer Detail MGI Mouse MGI:707623

D3Mit147 Primer Detail

Name

D3Mit147
Primer 1 Sequence

TCTGCCTCTGTTAGATAGATATCCG
Primer 2 Sequence

TTGTTCATCTATCCTCTGAAGTTCC
ID

MGI:707623
Product Size

134
Other IDs

D3Mit147 (BROAD)
Note

MIT assay: MT1018
Additional information: MIT STS Marker Data Files

D3Mit147

DNA segment, Chr 3, Massachusetts Institute of Technology 147

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit147	c	144bp	C57BL/6J
	D3Mit147	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit147	a	120bp	CAST/EiJ
	b	126bp	SPRET/EiJ
	c	128bp	AKR/J, LP/J
	d	132bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	144bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit147	c	131bp	CBA/CaOlaHsd
	D3Mit147	s	142bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24