About   Help   FAQ
D8Mit1 Primer Detail
Primers
  • Name
    D8Mit1
  • Primer 1 Sequence
    TTTTGCTGTCTAGGTCCTGACTC
  • Primer 2 Sequence
    CAGCCTCATTAGTAAGGGACCTT
  • ID
    MGI:707597
  • Product Size
    226
  • Other IDs
    D8Mit1 (BROAD)
  • Note
    MIT assay: M70
    Additional information: MIT STS Marker Data Files
Genes
D8Mit1 DNA segment, Chr 8, Massachusetts Institute of Technology 1
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D8Mit1 m 230bp MOLF/EiJ
s 240bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit1 a 215bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt, SPRET/EiJ
b 255bp CAST/EiJ
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/21/2024
MGI 6.23
The Jackson Laboratory