About   Help   FAQ
D13Mit144 Primer Detail
Primers
  • Name
    D13Mit144
  • Primer 1 Sequence
    AGGAGAATGCTAGGATTGTTTCC
  • Primer 2 Sequence
    GAAAAGATGCATATACATGTGATGC
  • ID
    MGI:707589
  • Product Size
    118
  • Other IDs
    D13Mit144 (BROAD)
  • Note
    MIT assay: MT921
    Additional information: MIT STS Marker Data Files
Genes
D13Mit144 DNA segment, Chr 13, Massachusetts Institute of Technology 144
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D13Mit144 a 121bp 129X1/Sv
f 121, 123bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit144 a 117bp DBA/2J
b 119bp A/J, B6.Cg-Lepob/+, LP/J, NOD/MrkTac
c 121bp C57BL/6J
d 123bp AKR/J, BALB/cJ, C3H/HeJ, NON/ShiLt
e 128bp CAST/EiJ
f 132bp SPRET/EiJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory