D13Mit147 Primer Detail MGI Mouse MGI:707588

D13Mit147 Primer Detail

Name

D13Mit147
Primer 1 Sequence

CATCCAGGAAGGCAATAAGG
Primer 2 Sequence

CAAATGCACAGTGCCGAG
ID

MGI:707588
Product Size

108
Other IDs

D13Mit147 (BROAD)
Note

MIT assay: MT738
Additional information: MIT STS Marker Data Files

DNA segment, Chr 13, Massachusetts Institute of Technology 147

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit147	a	93bp	129X1/Sv
Not Specified	D13Mit147	f	104, 108bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit147	a	93bp	BALB/cJ, C3H/HeJ, LP/J, NON/ShiLt
	b	104bp	AKR/J, DBA/2J
	c	108bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	d	110bp	A/J
	e	116bp	SPRET/EiJ

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit147	c	larger	CBA/Kw
	D13Mit147	e	smaller	KE

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23