About   Help   FAQ
D13Mit147 Primer Detail
Primers
  • Name
    D13Mit147
  • Primer 1 Sequence
    CATCCAGGAAGGCAATAAGG
  • Primer 2 Sequence
    CAAATGCACAGTGCCGAG
  • ID
    MGI:707588
  • Product Size
    108
  • Other IDs
    D13Mit147 (BROAD)
  • Note
    MIT assay: MT738
    Additional information: MIT STS Marker Data Files
Genes
D13Mit147 DNA segment, Chr 13, Massachusetts Institute of Technology 147
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D13Mit147 a 93bp 129X1/Sv
f 104, 108bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit147 a 93bp BALB/cJ, C3H/HeJ, LP/J, NON/ShiLt
b 104bp AKR/J, DBA/2J
c 108bp B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac
d 110bp A/J
e 116bp SPRET/EiJ
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D13Mit147 c larger CBA/Kw
e smaller KE
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory