About   Help   FAQ
D13Mit141 Primer Detail
Primers
  • Name
    D13Mit141
  • Primer 1 Sequence
    CTTGGACACATCCCTAACATACA
  • Primer 2 Sequence
    ATTGACATATATACAACACAATGAGGG
  • ID
    MGI:707586
  • Product Size
    103
  • Other IDs
    D13Mit141 (BROAD)
  • Note
    MIT assay: MT1088
    Additional information: MIT STS Marker Data Files
Genes
D13Mit141 DNA segment, Chr 13, Massachusetts Institute of Technology 141
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D13Mit141 a 107bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
b 111bp DBA/2J
c 117bp CAST/EiJ
d 119bp SPRET/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D13Mit141 c larger C58/J
f not given FVB/NJ
i not given I/LnJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory