About   Help   FAQ
D19Mit75 Primer Detail
Primers
  • Name
    D19Mit75
  • Primer 1 Sequence
    CTTCCTCTGCTTGTGTGAAGG
  • Primer 2 Sequence
    ACACAAACATTTTACACATGACCC
  • ID
    MGI:707562
  • Product Size
    97
  • Other IDs
    D19Mit75 (BROAD)
  • Note
    MIT assay: MT3195
    Additional information: MIT STS Marker Data Files
Genes
D19Mit75 DNA segment, Chr 19, Massachusetts Institute of Technology 75
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit75 m 100bp MOLF/EiJ
s 132bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit75 a 92bp LP/J
b 94bp A/J, AKR/J, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NON/ShiLt
c 96bp B6.Cg-Lepob/+, NOD/MrkTac
d 112bp CAST/EiJ
e 114bp SPRET/EiJ
J:61322 Montgomery JC, et al., MGI Direct Data Submission. 2000;
Endonuclease Gene Allele Fragments Strains
D19Mit75 a 105bp AEJ/Gn
s 114bp M. spretus
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:61322 Montgomery JC, et al., Chromosomal localization of the mouse G protein-coupled receptor kinase 5 and 6 genes. MGI Direct Data Submission. 2000;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory