About   Help   FAQ
D5Mit197 Primer Detail
Primers
  • Name
    D5Mit197
  • Primer 1 Sequence
    TCAGTGATAATGACATGGTAGAAGTG
  • Primer 2 Sequence
    AGAGGGTTTCCTTCCCCC
  • ID
    MGI:707559
  • Product Size
    149
  • Other IDs
    D5Mit197 (BROAD)
  • Note
    MIT assay: MT1398
    Additional information: MIT STS Marker Data Files
Genes
D5Mit197 DNA segment, Chr 5, Massachusetts Institute of Technology 197
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D5Mit197 b 0.154kb C57BL/6
c 0.114kb B10.BR-H2k, BALB/cAnNCr, BALB/cByJ, BALB/cJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit197 a 114bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
b 146bp SPRET/EiJ
c 150bp CAST/EiJ
d 154bp B6.Cg-Lepob/+, C57BL/6J, LP/J
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory