D4Mit236 Primer Detail MGI Mouse MGI:707548

D4Mit236 Primer Detail

Name

D4Mit236
Primer 1 Sequence

TCTTAGCATGCTTACCGCCT
Primer 2 Sequence

GGCCCGTAGGATGACTGTC
ID

MGI:707548
Product Size

202
Other IDs

D4Mit236 (BROAD)
Note

MIT assay: MT3846
Additional information: MIT STS Marker Data Files

D4Mit236

DNA segment, Chr 4, Massachusetts Institute of Technology 236

J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D4Mit236	b	0.204kb	B10.BR-H2^k, C57BL/6
Not Specified	D4Mit236	c	0.188kb	B10.D2-H2^d, BALB.K-H2^k, BALB/cAnNCr, BALB/cByJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit236	a	160bp	CAST/EiJ
	b	188bp	AKR/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac
	c	190bp	A/J
	d	202bp	NON/ShiLt
	e	204bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J
	f	220bp	SPRET/EiJ

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit236	a	smaller	129P3/J
	D4Mit236	s	larger	SJL/J

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit236	c	smaller	CBA/Kw
	D4Mit236	k	larger	KE

J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 03/18/2025 MGI 6.24