About   Help   FAQ
D4Mit234 Primer Detail
Primers
  • Name
    D4Mit234
  • Primer 1 Sequence
    TTGTAATCCTCTCCCTTTAAAACA
  • Primer 2 Sequence
    AACCCTGGACAGCAAGTCC
  • ID
    MGI:707546
  • Product Size
    148
  • Note
    MIT assay: MTH208
Genes
D4Mit234 DNA segment, Chr 4, Massachusetts Institute of Technology 234
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D4Mit234 a 153bp 129X1/Sv
f 115, 141bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit234 a 111bp CAST/EiJ
b 115bp NOD/MrkTac
c 129bp DBA/2J
d 133bp SPRET/EiJ
e 141bp AKR/J, C3H/HeJ, NON/ShiLt
f 153bp A/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
g 161bp LP/J
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D4Mit234 c not given C58/J
f not given FVB/NJ
i larger I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D4Mit234 c 230bp CBA/CaOlaHsd
s 249bp SWR/OlaHsd
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D4Mit234 a 153bp 129/SvW, A.CA/W, BALB/cW, C57BL/6W, C57BL/10W
b 141bp AKR/W, C3H/W, CBA/W
c 129bp BN/aW, DBA/2W
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory