About   Help   FAQ
D11Mit41 Primer Detail
Primers
  • Name
    D11Mit41
  • Primer 1 Sequence
    CTGCTAAAGTGGGGTTAAATGC
  • Primer 2 Sequence
    CGACTGAGCAAGTTGTATTTCTG
  • ID
    MGI:707539
  • Product Size
    134
  • Other IDs
    D11Mit41 (BROAD)
  • Note
    MIT assay: B279
    Additional information: MIT STS Marker Data Files
Genes
D11Mit41 DNA segment, Chr 11, Massachusetts Institute of Technology 41
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit41 a 130bp SPRET/EiJ
b 136bp B6.Cg-Lepob/+, C57BL/6J
c 140bp CAST/EiJ
d 166bp A/J, AKR/J, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac
e 178bp BALB/cJ, NON/ShiLt
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D11Mit41 l larger LG/J
s smaller SM/J
J:104037 Grzmil P, et al., MGI Direct Data Submission. 2006;
Endonuclease Gene Allele Fragments Strains
D11Mit41 c lower CBA/Kw
k upper KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:104037 Grzmil P, et al., Mapping of mouse Chromosome 2, 11 STS markers in CBXE and EXCB RI strains. MGI Direct Data Submission. 2006;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
04/23/2024
MGI 6.23 		The Jackson Laboratory