About   Help   FAQ
D5Mit78 Primer Detail
Primers
  • Name
    D5Mit78
  • Primer 1 Sequence
    AGGGGATCTTTCAAAGTCATAGC
  • Primer 2 Sequence
    TGCTCAATCCTTAATACACACACT
  • ID
    MGI:707522
  • Product Size
    123
  • Other IDs
    D5Mit78 (BROAD)
  • Note
    MIT assay: MPC1408
    Additional information: MIT STS Marker Data Files
Genes
D5Mit78a DNA segment, Chr 5, Massachusetts Institute of Technology 78a
D5Mit78b DNA segment, Chr 5, Massachusetts Institute of Technology 78b
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit78a a 110bp SPRET/EiJ
b 114bp CAST/EiJ
c 122bp BALB/cJ, DBA/2J
d 124bp A/J, AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, LP/J, NON/ShiLt
e 126bp NOD/MrkTac
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit78a c 219bp CBA/CaOlaHsd
s 210bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory