About   Help   FAQ
D7Mit22 Primer Detail
Primers
  • Name
    D7Mit22
  • Primer 1 Sequence
    AGCCCCTTCTTCTCCAAGAG
  • Primer 2 Sequence
    TGAAGGAGTAGTCAACAGAGTAAATGC
  • ID
    MGI:707509
  • Product Size
    216
  • Note
    MIT assay: D520
Genes
D7Mit22 DNA segment, Chr 7, Massachusetts Institute of Technology 22
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit22 a 198bp LP/J
b 208bp SPRET/EiJ
c 216bp NOD/MrkTac
d 218bp B6.Cg-Lepob/+
e 220bp A/J, AKR/J, C3H/HeJ, C57BL/6J, DBA/2J, NON/ShiLt
f 222bp BALB/cJ
g 232bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D7Mit22 c 104bp CBA/CaOlaHsd
s 103bp SWR/OlaHsd
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D7Mit22 a smaller 129P3/J
s larger SJL/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/21/2024
MGI 6.23
The Jackson Laboratory