About   Help   FAQ
D7Mit25 Primer Detail
Primers
  • Name
    D7Mit25
  • Primer 1 Sequence
    AGGGGCACATGTTCAACTATG
  • Primer 2 Sequence
    GGTTGTTTCCAGCTTTGGG
  • ID
    MGI:707508
  • Product Size
    106
  • Note
    MIT assay: M55
Genes
D7Mit25 DNA segment, Chr 7, Massachusetts Institute of Technology 25
Polymorphisms
J:19730 Seldin MF, et al., J Clin Invest. 1994 Jul;94(1):269-76
Endonuclease Gene Allele Fragments Strains
Not Specified D7Mit25 a 102bp A/J
b 110bp C57BL/6J
c 96bp C3H-Faslgld
s 78bp M. spretus
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit25 a 78bp SPRET/EiJ
b 96bp C3H/HeJ, LP/J, NON/ShiLt
c 102bp A/J, AKR/J, BALB/cJ, NOD/MrkTac
d 108bp DBA/2J
e 110bp B6.Cg-Lepob/+, C57BL/6J
f 144bp CAST/EiJ
References
J:19730 Seldin MF, et al., Glycogen synthase: a putative locus for diet-induced hyperglycemia. J Clin Invest. 1994 Jul;94(1):269-76
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory