About   Help   FAQ
D7Mit26 Primer Detail
Primers
  • Name
    D7Mit26
  • Primer 1 Sequence
    TTGCTCCTCCAATCCAGC
  • Primer 2 Sequence
    CCCAGACCCAGACAGATGTT
  • ID
    MGI:707505
  • Product Size
    195
  • Note
    MIT assay: D651
Genes
D7Mit26 DNA segment, Chr 7, Massachusetts Institute of Technology 26
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit26 a 172bp SPRET/EiJ
b 178bp CAST/EiJ
c 190bp A/J, BALB/cJ
d 194bp AKR/J, B6.Cg-Lepob/+, C3H/HeJ, NOD/MrkTac, NON/ShiLt
e 198bp DBA/2J, LP/J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D7Mit26 l larger LG/J
s smaller SM/J
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D7Mit26 a smaller 129P3/J
s larger SJL/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory