About   Help   FAQ
D14Mit165 Primer Detail
Primers
  • Name
    D14Mit165
  • Primer 1 Sequence
    TGTACATTAAATTTGGAAACCTGG
  • Primer 2 Sequence
    ACTACACTTTCAGCATAAGACACACA
  • ID
    MGI:707493
  • Product Size
    134
  • Other IDs
    D14Mit165 (BROAD)
  • Note
    MIT assay: MT2220
    Additional information: MIT STS Marker Data Files
Genes
D14Mit165 DNA segment, Chr 14, Massachusetts Institute of Technology 165
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D14Mit165 c 121bp C3HeB/FeJLe
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit165 a 121bp A/J, AKR/J, BALB/cJ, C3H/HeJ
b 134bp LP/J
c 135bp SPRET/EiJ
d 136bp B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac
e 146bp CAST/EiJ
f 151bp DBA/2J
g 160bp NON/ShiLt
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D14Mit165 c larger C58/J
f not given FVB/NJ
i not given I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D14Mit165 c 124bp CBA/CaOlaHsd
s 136bp SWR/OlaHsd
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D14Mit165 a 151bp DBA/2W
b 136bp C57BL/6W, C57BL/10W
c 121bp 129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W, CBA/W
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory