D14Mit160 Primer Detail MGI Mouse MGI:707490

D14Mit160 Primer Detail

Name

D14Mit160
Primer 1 Sequence

CAAAATTAGCAAGGATTCCAGG
Primer 2 Sequence

AGTTTAATCTCTTGGCTTTTGGG
ID

MGI:707490
Product Size

139
Note

MIT assay: MT2344

DNA segment, Chr 14, Massachusetts Institute of Technology 160

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit160	a	141bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	b	145bp	LP/J
	c	156bp	SPRET/EiJ
	d	160bp	AKR/J, C3H/HeJ, CAST/EiJ, DBA/2J
	e	162bp	A/J, BALB/cJ, NON/ShiLt

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D14Mit160	a	150bp	AKR/OlaHsd
	b	136bp	C57BL/6JOlaHsd, C57BL/10, SJL/J
	c	156bp	BALB/cJ, C3H/HeJ
	d	138bp	DBA/2J
	g	140bp	129P3/J
	j	154bp	JF1
	p	158bp	A/JOlaHsd, PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24