About   Help   FAQ
D14Mit160 Primer Detail
Primers
  • Name
    D14Mit160
  • Primer 1 Sequence
    CAAAATTAGCAAGGATTCCAGG
  • Primer 2 Sequence
    AGTTTAATCTCTTGGCTTTTGGG
  • ID
    MGI:707490
  • Product Size
    139
  • Note
    MIT assay: MT2344
Genes
D14Mit160 DNA segment, Chr 14, Massachusetts Institute of Technology 160
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit160 a 141bp B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac
b 145bp LP/J
c 156bp SPRET/EiJ
d 160bp AKR/J, C3H/HeJ, CAST/EiJ, DBA/2J
e 162bp A/J, BALB/cJ, NON/ShiLt
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D14Mit160 a 150bp AKR/OlaHsd
b 136bp C57BL/6JOlaHsd, C57BL/10, SJL/J
c 156bp BALB/cJ, C3H/HeJ
d 138bp DBA/2J
g 140bp 129P3/J
j 154bp JF1
p 158bp A/JOlaHsd, PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory