About   Help   FAQ
D2Mit265 Primer Detail
Primers
  • Name
    D2Mit265
  • Primer 1 Sequence
    AATAATAATCAAGGTTGTCATTGAACC
  • Primer 2 Sequence
    TAGTCAAAATTCTTTTGTGTGTTGC
  • ID
    MGI:707486
  • Product Size
    105
  • Other IDs
    D2Mit265 (BROAD)
  • Note
    MIT assay: MT2214
    Additional information: MIT STS Marker Data Files
Genes
D2Mit265 DNA segment, Chr 2, Massachusetts Institute of Technology 265
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D2Mit265 b 0.103kb B10.BR-H2k, B10.D2-H2d, BALB.K-H2k, C57BL/6
c 0.139kb BALB/cAnNCr, BALB/cByJ, BALB/cJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit265 a 90bp NOD/MrkTac
b 103bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J
c 111bp CAST/EiJ
d 133bp NON/ShiLt
e 139bp A/J, BALB/cJ, LP/J
f 146bp C3H/HeJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D2Mit265 l larger LG/J
s smaller SM/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D2Mit265 a 139bp BALB/cW, BN/aW, CBA/W
b 130bp AKR/W
c 110bp 129/SvW, A.CA/W
d 103bp C3H/W, C57BL/6W, C57BL/10W, DBA/2W
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory