DXMit31 Primer Detail MGI Mouse MGI:707446

DXMit31 Primer Detail

Name

DXMit31
Primer 1 Sequence

TTATGTGCTTATTAGCCAAGGTG
Primer 2 Sequence

AAAATAGAACTTCAGCAGCATGC
ID

MGI:707446
Product Size

112
Note

MIT assay: MPC126

DXMit31

DNA segment, Chr X, Massachusetts Institute of Technology 31

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
DXMit31	a	70bp	SPRET/EiJ
	b	74bp	CAST/EiJ
	c	96bp	AKR/J, BALB/cJ
	d	114bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	DXMit31	a	114bp	129/SvW, A.CA/W, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
	DXMit31	b	96bp	AKR/W, BALB/cW

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13