About   Help   FAQ
DXMit31 Primer Detail
Primers
  • Name
    DXMit31
  • Primer 1 Sequence
    TTATGTGCTTATTAGCCAAGGTG
  • Primer 2 Sequence
    AAAATAGAACTTCAGCAGCATGC
  • ID
    MGI:707446
  • Product Size
    112
  • Note
    MIT assay: MPC126
Genes
DXMit31 DNA segment, Chr X, Massachusetts Institute of Technology 31
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit31 a 70bp SPRET/EiJ
b 74bp CAST/EiJ
c 96bp AKR/J, BALB/cJ
d 114bp A/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
DXMit31 a 114bp 129/SvW, A.CA/W, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
b 96bp AKR/W, BALB/cW
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory