About   Help   FAQ
D14Mit98 Primer Detail
Primers
  • Name
    D14Mit98
  • Primer 1 Sequence
    TCTTAAATACTCACTCTGTGGTGAGG
  • Primer 2 Sequence
    CTCCATGAAGCACCCACAC
  • ID
    MGI:707403
  • Product Size
    150
  • Other IDs
    D14Mit98 (BROAD)
  • Note
    MIT assay: MT717
    Additional information: MIT STS Marker Data Files
Genes
D14Mit98 DNA segment, Chr 14, Massachusetts Institute of Technology 98
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D14Mit98 a 168bp 129X1/Sv
f 164, 168bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit98 a 146bp C3H/HeJ, DBA/2J, LP/J
b 150bp B6.Cg-Lepob/+
c 152bp BALB/cJ, C57BL/6J
d 161bp CAST/EiJ
e 164bp A/J, AKR/J, NOD/MrkTac, NON/ShiLt
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory