D14Mit97 Primer Detail MGI Mouse MGI:707402

D14Mit97 Primer Detail

Name

D14Mit97
Primer 1 Sequence

TCAGTCCAAACTCTGTTAATCTTCC
Primer 2 Sequence

CAGCTCCACATTTTTGCTCA
ID

MGI:707402
Product Size

136
Other IDs

D14Mit97 (BROAD)
Note

MIT assay: MPC2247
Additional information: MIT STS Marker Data Files

D14Mit97

DNA segment, Chr 14, Massachusetts Institute of Technology 97

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D14Mit97	b	larger than f	C57BL/6J
	c	161bp	C3HeB/FeJLe
	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit97	a	149bp	B6.Cg-Lep^ob/+
	b	155bp	C57BL/6J, NON/ShiLt
	c	157bp	AKR/J
	d	161bp	A/J, BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J, LP/J, NOD/MrkTac
	e	169bp	SPRET/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D14Mit97	b	130bp	A/JOlaHsd, C57BL/6JOlaHsd
	d	132bp	AKR/OlaHsd, BALB/cJ, C3H/HeJ, DBA/2J, JF1
	g	128bp	129P3/J
	l	124bp	C57BL/10, SJL/J
	p	122bp	PWB

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D14Mit97	a	larger	129P3/J
	D14Mit97	s	smaller	SJL/J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24